583: A Man Talking

Stewart Lee matinée, The Lowry, Salford, 29^th April

There was some loud music and a man in the far distance walked onstage. It's lucky I'd just got some new glasses two days earlier or I may have struggled to pick out any features of the moving black and grey blob. There was a little smoke; just the right amount. He started talking and saying things. Sometimes he moved about a little while saying things. Other times he stopped talking and moved more. People were laughing. The person I had bought the other ticket for fell asleep. Someone, left of centre, row L, upper circle, was laughing with such screeching abandon that the man on stage made passing reference to it. Row L is the second from the very back in a 2000-seater auditorium.

There was a bit where he talked about some stuff, and another bit where he talked about some other stuff. Then there was an interval where I was able to stand in a public toilet staring at the backs of urinating men before getting my own chance to urinate while being all to aware of the uncomfortable impatient eyes on my own back. Then I went back in and sat down again. Then I waited a little bit. Not too long. Then the talking man came back onstage and did more talking. There was a lot more laughing. Then seventeen semi-naked dancing girls came onstage and the talking man strapped himself into the seat of a flying drum kit which somersaulted and pirouetted over the sleeping heads of the audience. Then, upon landing, he took out a scalpel and peeled the flesh and skin off his hand and forearm revealing the mechanical metal workings within.

For the ultimate climax of the show we, the audience, were split into two categories, those who laughed and those who didn't, and herded into separate windowless trains. Those who laughed were taken to a location and allowed to proceed with their lives as normal, and those who didn't laugh were taken to the same location and allowed to proceed with their lives as normal. The same place and thing just different trains. We could have walked really. Afterwards a man in an exceedingly tall top hat spake to us through a megaphone and made us feel small. Then we walked home in the cold wind. Passing the big mysterious building with the words 'Manchester United' emblazoned on the side, we wondered what it could possibly mean and what might happen in such a strange and unknowable building. It's certainly too big to be someone's house.

The man was very good at talking. I would like to listen again. If you have enjoyed listening to him talk in the past you will probably enjoy listening to him talk in the present, or even in the future. If you have not enjoyed listening to him talk in the past you will probably not enjoy listening to him talk in the present, or even in the future. I liked it.

Me liking it, and the talking man.

582: Random Topic Generator 2: Avoiding the Flue

Playing again with the Random Topic Generator I was surprised to be given the subject Avoiding the Flue. Yes, Avoiding the Flue. The Flue. Flue. A pipe for removing vapours, fumes or smoke from an area, for example a chimney. Avoiding the Flue. How to spend as little time as possible interacting with chimneys. Avoiding the Flue. Flues to be avoiding. Keeping ones distance from flues. It is fortunate for travellers in the Harry Potter universe that JK Rowling decided to misspell the word as floo. Flues are to be avoided; floos are to be travelled via. Important distinction. Don't be confused.

Most people have no real worry with regard to avoiding the flue. Chimneys are often blocked up in old houses and rarely or never installed in modern houses. Flues, where they are installed, are usually to vent steam from boilers or to allow oxygen into heaters to prevent the production of the deadly gas carbon monoxide. Unless you are some sort of qualified certified gas fitter you shouldn't be messing about with these. Poorly installing or maintaining this equipment is a crime punishable with derision and detention. Don't do it. Avoid the flue like the plague.

If you're Father Christmas, the Grinch, god or Jack Skellington, then flues and chimneys are unfortunately an occupational hazard. As you know Father Christmas uses his magicks to transport him down any heating-related venting aperture so as to deposit parcels of branded shop-bought merchandise into the living rooms of the world's families. The Grinch, god and Jack Skellington are involved in the periodic imitation of Father Christmas, usually only when the whim takes hold of them. God also makes the tenuous claim to be everywhere at all times. So he is both in chimneys and away from them; having his cake and eating it too. There is no real advise I can offer these guys. They will just have to tolerate the flue as I see no way it can be avoided.

It might have made more sense, and been of more value, had the Random Topic Generator suggested the subject Avoiding the Flu. But it didn't, did it. It suggested Avoiding the Flue. So there we are. No advice about no subject. Be well, and may your life be happily free from flue/flu, delete as preferred.

581: Counting Chickens and Eggs

You've got chickens. Six of them to be precise. They live in a hutch in the back garden and each morning you let them out into a fenced-off area of lawn. They cluck about the place, occasionally making futile flapping leaps up to or down from the fence. Every morning you provide water and food, and in return they buckbuck appreciatively and present a freshly laid egg. But wait. There are only five eggs. The evidence of the second sentence suggests that one should expect to see six eggs. Perhaps it's just an anomaly, a statistical blip. Check back the next day; hutch open, buckbuck, food water, still only five eggs. Again and again, day after day. One chicken is not pulling its weight.

Of course you are going to want to root out the dodger, prune the wastrel and expunge the weakling, but what is the best way to do it. I am going to set forth the best ways of identifying which chicken has laid which egg. This is very important. Unless this is done you may find the other chickens thinking well she's getting away with not laying so why am I bothering to squeeze one out of my cloaca every day just so that big thing can carry it away into its giant hutch. When this happens you'll soon find they all stop a-laying. This is simply to be avoided blah blah blah.

The first method is to obtain some pellets of uranium. This shouldn't be too much trouble so don't quibble about technical difficulties. You'll also need a Geiger counter and some chicken feed. Day one: take aside one of the chickens and feed her, separately from the others, with a mixture of chicken feed and uranium pellets. Test, with the Geiger counter, the eggs that are laid the next day. If none of them register as radioactive you have found your lazy chicken. If one is radioactive then the first chicken is off the hook. Repeat the process with the next chicken, and the next... until you have an answer. Don't worry about the radioactivity in the eggs, you can still eat them. Radioactivity is full of health-bringing properties and will lend you a warm attractive glow.

If, for some reason, you find it difficult getting hold of uranium (you're pathetic) then you may want to try this next method. Take six different colours of paint, in tubes, and squeeze each tube into the the cloaca of each chicken. The next day each egg will be brightly coloured in five of the six chromas. This method has the advantage of only taking one day and one night, whereas the previous method could take up to a week. You will be delighted by the brightly coloured eggs which are fun for children and adults alike.

The last method requires six boxes big enough to comfortably house one chicken for a night, but where are you going to get those from. Although it's pie-in-the-sky nonsense I may as well indulge. Stick the chickens in the boxes. Next day each box will contain one chicken and one egg. One box will contain a chicken but no egg. There is your slacker. Eat it. Or give it a telling off. Or give it therapy; ask it to open up about its relationship with father and mother; about its thoughts and worries. Take it to the chicken doctor to have its pipes examined. If he asks why the chicken is glowing and its back end is stuffed up with paint then run, run as fast as you can.

580: Random Topic Generator

Here is a random subject generator; a tool for bloggers utterly devoid of inspiration and internal thought process. It's been almost twenty four hours since the last time I was called upon to write words, on a piece of non-existent paper, and during that time I've slept, been to work, spoken to various people about various things, shopped for spectacle frames, eaten Greek lamb and lentils in Manchester Arndale Market food court, ridden the tram, had a nap, watched a pretty good music video that features a friend's severed head mounted on a wall, made and eaten a delicious shepherds' pie, and here we all are. Also during that time my friend and godson have come to stay with us from Tanzania.

Despite all this activity I am reduced to clawing helplessly at the dregs of the random subject generator. How random it is, I do not know, since I have only seen, so far, the first subject it has generated. It is possible, and indeed likely, that it only actually has five subjects which it serves up cyclically in order to every helplessly empty-minded sucker who sucks. And here I am, helpless, empty-headed, and sucking, and the subject served to me is The autonomy of nude art. What this piece of code doesn't know is that I have already done my blog about nude art, here: My "Private" Library. What it also doesn't know is that I finished my art degree about seven years ago, and thus have no interest nor reason in unpicking the meaning behind pretentious phrases like The autonomy of nude art. There's just no need. No need at all.

Your favourite novels; Simple origami; Religions – ranked by age; A word that means something to you; Where to rent good snowboards; Chocolate, good or bad for you?; Nutrition for young kids; Your worst enemy; Your favourite dinosaur; The birth of Jazz; George Washington in the Revolutionary War; Cities to visit; DNA notations; A movie poster that has affected you; Music and mathematics; How to cut your spending. Those are the topics. There may be others but we haven't got all day. I can't tackle all of those so I'm just going to throw darts at the screen and wherever they stick, that subject, by dint of blind chance, becomes worthy of a sentence or two.

DNA Notations:

CTACGATCGATCGTACTGATCGTAGCTAGCTAGTCGATCGATCGTAGTCGATGCTACGTAGCTAATGACGATGCTATGCATAGTCGTACGTACGTGTGTGTTTAATTATATCGATCGATCGATCGATGCGCGCTACGTACGATCGATGCTAGCTAGCTAGCTAGCTGATCGATCGTAGTCGATCGTATATGCGGTCAGCGATGTATCGGGCGCGGGGGGCGCGAGATAGTATGCATGTAGCTTAGGAC

Cities to visit:

All of them, from Aalborg to Żywiec.

Where to rent good snowboards:
I don't know. Halfords, or somewhere.

A word that means something to you:
Word.

How to cut your spending:
Stop saying, "oh my god, I need those shoes, I don't know when I will wear them, but they are just so cute. Should I get them? I'm getting them."

Well, that went well.  More of the same tomorrow?

579: Apprentices and Myself

You try and take me on and you might as well try and drown a shark. I'm a frequent flier, a blue sky thinker, an out of the box talker. You want original ideas, first class leadership, and awesome aptitude for anything and everything, then come to myself, I'm your man. I'm the new apprentice. I'm, like, just the fucking best and you are all a bunch of fucking idiots. Just look at myself. I mean, seriously, just look. Yeah? Are so seeing it? I bet you are, yeah. Goddamn, I'm good. And so, so smart, handsome, charismatic, humble. Give me a pound and a week and I'll give you a thousand pounds. Give me a year and I'll give you a million. Two years; ten million. I'm serious.

Now Lord Sugar, Alan, Al, can I call you Al? Lord Sugar, all the good ideas originated with myself, and all the bad ideas were the woman's fault. Fire the woman so it's just us blokes. Me, myself, and my hand-shaking, high-fiving, bullshitting, boys. Examples? You want examples? Well, fine, no problem; I got examples coming out my motherfucking ass, Lord Sugar. I was great a selling, and generating ideas. Footfall. I sold, sold, sold. I was tasked with monitoring footfall, generating numbers, and finalising, aligning, and crunching. You give me a job and you can be sure it will be done, withing or before the allotted time required for completion. Give me two jobs and I'll do them both. I'm like a plate spinner with three balls. I keep them all balanced on fingers and noses. When I say it's done you know it's done.

Marketing and sales, the two greatest modern art signs of a genius. Well, Lord Sugar, this is my face, and this is the sign of a genius. I know what I'm doing because I wasn't born into money. Not everyone can work up and get what I've got through myself and myselves on efforts. See this watch? I bought this by myself. My dad didn't even help or nuffink, Lord Sugar. Yeah, well it's a second generation family business. Yes, my dad did start it, but honestly that's not why I got the opportunity. I joined my dad's family business through dedication and hard work, spit and oil, dry skin and force. And with or without you Dad, I mean, Lord Sugar, sorry, easy mistake. But at this point I just want to say that I have so much more to prove. Give me another chance to show you and I won't let you down. Please, please, I can change, I can change.

OK, thank you for the opportunity, Lord Sugar. Good luck, guys. Goodbye everyone. Are you sure it's myself wot's fired? Oh, ok, just checking. I'm thorough like that. And determined. And... No, it's ok, I'll leave. Dicks.

578: Tom Waits in Specsavers, Kevin waits in Specsavers

I'm in Specsavers, or I was, I'm not now. Suspend your disbelief if you can. I'm in Specsavers, and they told me I would have to wait fifty minutes. Then they said maybe sixty, but they might try and get me in early if I could refrain from spilling apple juice on the carpet and scrawling wax crayon on the walls. I need new glasses. That's why I was there. Sitting in the back of the shop, staring out into the distance, out of the door and across the Arndale to the pound shop. Watching the other poor-sighted people stretching their weary legs. I wasn't watching anyone, I was reading a book. About all the elements of the periodic table. The building blocks of you and me and everything in between and everywhere else too.

There was music on. First there was that I wanna be a Dord, I want to be adored by the Manchester band whose name I can't remember right now, but I understand they were very popular. Then there was another song by that other Manchester band, you know the shit one everyone likes. Oasis. Then I wasn't listening to the music anymore because, you know, Oasis. Then I thought I was being called in but it was just to get my retinas photographed by a friendly trainee optician. Later the big boss optician would show me those photographers and compliment me on a nice set of blind spots. My shoes were dusty from the stock room at work, and I had a carrier bag with some books and a half eaten Eccles cake.

Some people who arrived probably thirty minutes after I did went in to see the optician before me. Every other person waiting received occasional personal apologies for the long wait, Mr Smith, sorry about your wait, Mr. Mohammad, apologies for the delay, don't worry, you're next, Mr Almqvist, sorry sorry sorry. This is outrageous I thought, then I had a little nap. Instead of making a little complaint -excuse me but I would like to be seen this week- I convinced myself that the people arriving after and being seeing before me had made appointments in advance. I started this blog post in the present tense, and made a point of pointing out the point, and at some point since then I have slipped into past tense.

The optician was nice. See said my glasses were scratched but my eyes were healthy and not getting any worse. When she shined a light in through my pupils and peered at the retina I asked if she could see my brain. She said, no, that's a bit further back and she couldn't see cos she didn't have her glasses on. She didn't say that, but I just thought it would have been a little bit funny if she had. She just said, no, I'm looking at your retinas. When the tests were all done and my prescription was printed she pressed a button and a little man came running in through the door -he wasn't little, he was considerably taller than I am- and started giving me sales pitches and all that. I extricated myself, not wishing to go through the faff of picking new frames. But back I'll need to go soon enough.

Oh, I forgot to mention that while waiting, an age after Oasis was played, I was surprised to hear a Tom Waits song. Hence the title of this blog post. It wouldn't have made much sense if I hadn't mentioned it now, would it. Jockey Full of Bourbon. 

Because I'm an Artist n that or whatever

577: Two Big Beards

On the night I saw Laibach I saw, separately, two of the grandest and most wonderful beards I have ever seen in my life. The first was on Moss Lane, and was crossing the road attached to the face of a man. The man had wild and long mousy-brown hair and one of those indistinct faded-to-grey band t-shirts. The beard growing from the follicles of his face was something so special I hope it will stay with me for the rest of my life. It jutted out of his face about 18 inches in all directions; bright, bright orange, looking like an explosion of carrot juice forcing its way out of his stomach and into space at 115mph.

Although the owner of this exciting new work in the field of beard sculpture was some considerable distance down the road when I sighted him, the stunning size and considerable colour of this fiery facial fuzz lent it more than enough power to function practically as a hi-vis beard. Its high visibility allows for the wearer to cross the road in near darkness safe in the knowledge that even the blindest of careless drivers will see that beard from a safe stopping distance away.

Still reeling from the religious experience of seeing a big orange beard on the face of a man without bright orange hair on his head, I didn't expect to be further gifted by the god of note-worthy beards. But gifted I was whilst waiting for Laibach to take the stage, one of the fellows who fiddles with the knobs and wires wandered about doing his job. As he lifted up this wire and moved it there, then plugged one thing into another, then slightly altered the positioning of a microphone stand, a room full of music fans suddenly became beard fans.

This man had no hair on his head, just the rays of reflected light, but from his chin ran a solid black hair-chain down past the neck, past the chest, oh my god past the belly-button, surely it can't keep going, past the waist, aww hell naww, past the knees! Not quite, but its other end was bobbing around his knees. He looked like the sort of bloke you see on TV programmes about world record breakers, like he should have been swinging concrete blocks around his head. When he knelt down to fiddle with the technology he swung the plaited beard around and threw it over his shoulder.

So know you know. Two people have beards. One is orange, one is long. Great, eh?

576: One for Ned (The One in which I take the Bait)

My own personal opinion is that comedy, like music, or cinema, or wrestling, can be an intellectually and emotionally stimulating art form, or it can be simplistic and dumb entertainment, good for a momentary chuckle but contributing nothing to 'the soul'. Stewart Lee's stylistic choices filter out those only interested in the quick shallow hit of Peter Kay or Michael McIntyre, but beneath the distraction of repetition and manufactured tedium are vast veins of metaphor, pathos, narrative, and indeed bathos. Stewart Lee's comedy doesn't just make me laugh -but it does make me laugh- it also reminds me what I love about the power of writing and of performance, and the power of good proper art to transcend genre boundaries and bare up well to repeated readings.

My words about Peter Kay earlier, rather than encouraging a defence of Peter Kay prompted a short and entirely misinformed tirade against Stewart Lee:

Yeah Peter Kay is shit same old formula, observations northern accents. Unlike Stewart Lee who has the 'popular = shit' and that other thing he does.........oh yeah that's it. Unless you count purposefully dragging 1topic to the point where its so not funny its funny. Well funny to those who follow the ' popular = shit'.

I know this is coming from someone who has probably only watched twenty minutes of a Stewart Lee routine out of the many hours that are available (four live DVDs, two series of Comedy Vehicle, three books, plus all the stuff he did with Richard Herring in the 90s), so it's not the most well informed of opinions. But it's the opinion of a good friend so I'm sure he won't mind me calling it out as total bullshit :P

Well, for a start Stewart Lee is a massive comic book and super hero fan, and has been for many years. This in itself is not particularly interesting, nor is it a devastating argument, but comics and the movies they spawn are certainly popular. For example, in the show Stand-Up Comedian, Lee does a long routine about the time he interviewed Ang Lee when he was directing Hulk. The butt of the joke is not some bullshit about how he doesn't like The Incredible Hulk now it is popular; it is about the embarrassment of making a poorly timed joke, and how that embarrassment can be piled on tenfold if the joke is misconstrued as being racially insensitive.

Throughout other pieces Lee has mocked religion, Mel Gibson, Joe Pasquale, Top Gear, pirates, Russell Brand, etc, etc, blah, blah, blah. But his work is not one dimensional so if all you see is him saying 'I'm jealous of Russell Brand because he's more famous' you are profoundly missing the point. Art, and it is art, uses metaphor –one topic used to discuss another [...patronising...]- and this is a tool frequently used by Stewart Lee.

Since modern art came about all artists have needed to consider their medium. Why have I chosen clay, wood, canvas, paint, steel, balloons, spoken word, comedy, as my medium? What does the medium itself say about the art contained within? Stewart Lee discusses, at great length, the role of the comedian and comedy, and from that comes his parodies of Joe Pasquale, Michael McIntyre and Frankie Boyle. Joe Pasquale was an old-school comedian famed for having writers who would steal jokes from no-name comedians working the clubs. Pasquale would then shamelessly tell other people's jokes on TV. Plagiarism. Stewart Lee did a routine criticising this practise which ended in him attempting to write a joke that Pasquale couldn't steal. It is a routine about originality.

If You'd Prefer a Milder Comedian, Please Ask For One is essentially one long routine about originality. In it Lee tries to work out his place in comedy. At the time of writing/recording the show the two biggest mainstream comedians were Michael McIntyre, an inoffensive foppish observational comedian, and Frankie Boyle, a deliberately disgusting comedian pushing at the limits of decency. Lee plays the role of lost wannabe attempting, and failing, to emulate the two popular, highly contrasting styles. As well as being a role it also has an element of truth, in exactly the same way that the very best wrestlers base their characters on their own failings and foibles.

So yes, some of the things that are the butt of his jokes are popular things, but they are not the butt because they are popular. They are the butt because they are shit; lacking in any cultural value; or they are not the butt at all, and are merely a narrative tool. The assumption that Stewart Lee mocks some popular things because he hates all popular things is clearly false. As false as the patently stupid idea that because something is popular it must be good. Plenty of good things are popular, plenty are unpopular. Plenty of popular things are shit; plenty of shit things are unpopular. For example this blog is deeply unpopular; however the analogy falls down there because I haven't yet decided if it's shit or not.

Part of the reason that comedians like Peter Kay are highly successful, whereas Stewart Lee is niche, is that Peter Kay's material works as individual jokes. Soundbites. There are lots of little stories, with punchlines and characters you recognise. Stewart Lee's material is a different kind of comedy entirely. It simply doesn't work in soundbites. The stories are long. This is not due to some massive failing on his part, but it is a choice (or perhaps a small failing that he has exploited well).

That said, it seems to me self evident that there will by necessity be loads of amazing things that are unpopular, and loads of shit things that are popular. This happens because marketing departments -you know, all the money people who rape art for its money making potential with no consideration for its real value- take the safest option, back things similar to previously successful ventures. The same shit gets bought and sold over and over. The exciting, difficult, adventurous stuff gets overlooked. This is why Hollywood movies based on books always stick in a romantic sub-plot, a happy ending, and a white lead actor. This is why Hollywood currently only makes sequels, revamps, or adaptions from comic books.

Tellingly, the comedian that is the butt of one of Lee's most sarcastic routines, is someone who is all but unknown. Tom O'Connor was apparently popular in the 1970s, but I've never heard of him. The joke is basically that Stewart Lee's mum saw Tom O'Connor performing on a cruise ship, where he did a great joke about a sardine, and until Stewart Lee is performing on cruise ships he will never be a success in the eyes of his mother. The jokes works because of, or in spite of, the fact that nobody knows who Tom O'Connor is.

It really doesn't matter for Stewart Lee's comedy whether the butt of the joke is popular or not; it matters whether they are sincere and original or not. It's not a case of "Popular = Shit"; rather a case of 'Shit = Shit, regardless of whether it's popular or not, but popular shit is usually easier to discuss'. That is all.

Nightnight.

575: Little bird

Little bird.

Little baby bird.

Little dead baby bird.

Little dead baby bird

lying on the pavement.

It looked like a squidgy little jelly baby, or a newborn kangaroo crawling through the thicket of its mother's fur seeking out the comfort of the pouch and its wee nip-nips. It's a little spot around the corner from here, where cute miniature songbirds dance and lark in the bushes, hop along the paving stones a few steps ahead of me as I walk to and from the bus stop. I almost stepped on the stray immobile dot, the featherless vaguely bird-shaped squelch, laid out on the ground, but with perfect timing my eyes focused on it and my foot darted to the side.

It looked too young to have being attempting flight, and there was no sign of a smashed egg that it might have dropped out of. How it got there is a mystery. Where it went is also a mystery. When I walked past the same spot later that day I had my eyes wide open, combing the ground back and forth in search of the dead baby bird. It wasn't there. There is a very old episode of The Simpsons, I can't remember which one it is, but I have the image in my head of the dog licking up a big black liquorice-looking beetle. The 'camera' angle is low down, looking up high, so the dog's nose and tongue is gigantic, filling the screen. This is how I imagine the eventual resting place of the poor wee baby bird. Who knows. It probably ended up on the bottom of the postman's boot.

Poor wee thing. What it could have made for itself had the nameless tragedy of its premature death not occurred. A moments silence please for quiet reflection.

Thank you. Your presence here is appreciated.

574: Peter Kay, Manchester's Uncle Knobhead

Apropos of nothing, today, I heard someone say 'Dancing? Dancing like Uncle Knobhead, were you? Uncle Knobhead, eh? Eh? Eh, eh, Uncle Knobhead, eh? Yeah, everyone's got one, haven't they? Haven't they, eh? Uncle Knobhead, yeah? [repeat ad infinitum et nausea]'. Oh great, I thought, Peter bloody Kay is here. In't he, eh? Eh, yeah? Peter Kay, eh? Yeah? (I don't know why I'm doing this 'eh, yeah' thing; I don't know if he does that because it's so long since I heard his crappy comedy show, but in my imagination it -along with remembering sweets and TV programmes- entirely comprises his routine.)

The point is, obviously, I fucking hate Peter Kay. Here is my review of him in brief; he's shit. Yep, that was it. Nothing more to say, but I'll give it a go. It is a fact that his shtick is just remembering things from a vague shared cultural childhood from the 1970s or 80s, and repeating it back to a braying stadium of arfing clapping yokels. Hahaha, that's funny cos I remember it too, hyulk-hyulk.

Here are some things I remember: Teenage Mutant Ninja Turtles (was it Ninja or Hero, they couldn't make up their minds could they. Always eating pizza weren't they, and throwing it about the place!); penny sweets (cost a penny, didn't they, DIDN'T THEY? ANSWER ME! What happened to penny sweets, eh? Inflation, wasn't it. They're called Haribo now, aren't they!); playing out (that was fun wasn't it); being a kid (like an adult but shorter and more immature, eh? Eh?). Etcetera, etc, &c.

What about the fact that he keeps releasing DVDs of the same show over and over again, just recorded in different venues. Or the fact that he cynically used the promise of giving one pound to charity, from each item of merchandise sold during his tour, in order to sell much more merchandise and further line his fat bank vault. In my opinion he should have given 100% of the merchandise profit to charity, and half of the ticket sales. And he raised money unquestioningly for the cancer fraud 'Dr' Burzynski. So Peter Kay does charity work, but it seems it is only ever high profile stuff that he can use to boost his own reputation. The majority of other touring comedians do a regular circuit of untelevised charity benefits and fundraisers. Richard Herring lugs a Scope collection bucket with him everywhere he goes.

Yes, I am a fan of Richard Herring and Stewart Lee, who also happen to have used comedians like Peter Kay as baddy figures of fun in their routines. So I am just copying them, aren't I, eh, eh? Well, yes. They are comedy experts so their opinion is more valid than mine. They write an entirely new show for each tour/DVD release. They are better. They are good. Peter Kay is not. So there. I'm off for some garlic bread.

Garlic bread.

Garlic.

Bread.

(P.S. Phoenix Nights was pretty good.)

573: Laibach, Manchester

We turned up at the Manchester Academy at about 7:20 and wandered around the student union until we found the smallest of the Academies; about fifteen floors up and down a hundred corridors, lined with posters advertising gigs, seminars and mental health research. Eventually we joined a very short queue of geeks and nerds in over-sized boots, arm-bands and military hats and coats. Some people were alone, others in small groups. When I bought my ticket I assumed I would be going alone, but fortunately my flatmate dredged up the cash, and I went accompanied. He has a friend whose grandfather served in an Indian army (possibly the Legion Freies Indien, thank you Wikipedia) allied with the Nazis against the Allied nations. He still has his grandfather's Indian Nazi uniform, and we joked, hilariously, about him wearing it to the Laibach gig, ha!

The doors should have opened at 7.30, but at 7.55 we were just being let in through the door, displaying a shocking lack of precision. My friend nipped off for a quick pray and I nipped in for two quick pints of fizzy piss. Apart from us, of course, the first people to turn up were freaks and nerds (and I mean no offence at all by those words), but later there was a trickle of middle-aged people in anoraks, and one Mick Hucknall lookalike. The two pints kept spraying out in waves sending me repeatedly to the toilet throughout the majority of the night. Before the band marched onstage incidental music from their soundtrack to the forthcoming sci-fi comedy 'Iron Sky', about Nazis from the moon, blasted out from the PA. I had to run to the toilet worried I'd miss the start of the show, but was back with plenty of time to spare. There was even a few calls of get on with it, but eventually Laibach graced us with their forceful and vaguely mythical presence.

Two hipster-looking nerds came onstage and began fiddling with keyboards and laptops. I took them to be technicians/roadies but they settled into place as the shaven-headed drummer took his seat. The iconic form of Laibach singer, and most recognisable member, Milan Fras -with his smart brown suit, Laibach belt-buckle, and desert headgear- stepped onstage followed by an entirely unexpected vision of terrifying beauty. Like some form of sexy cinema Nazi, dressed in tight black skirt, shirt and tie, hair tied back functionally, and head topped with a cap I imagine a WWII comms officer wearing, she marched onstage holding aloft a megaphone screaming feedback into its own mouthpiece. She barked orders at the crowd of suddenly besotted nerds and weirdos before taking up position behind her instrument. Enough, boy; I'm soon to be a married man and can't be carrying on like this. Let me just say, if I was sixteen again, her poster would be on my wall. I later discovered her name is Mina Špiler, and as well as her role in Laibach she is also singer in Slovene electro band Melodrom.

The band were so tight it hurt. The drums were fucking harsh; all songs perfect; almost jazzy atonal piano-bashing; Milan's voice, that penetrating pure bass sprechstimme, was a physical experience of undefined pleasure, and Mina sang with alternating screams and delicate beauty. Highlights of the show were 'Take Me To Heaven' from Iron Sky Soundtrack, 'America' and 'Anglia' from Volk, 'Alle Gegen Alle' from NATO, 'Leben - Tod' from Opus Dei, and most surprising of all, the utterly beautiful 'Across the Universe' from Let It Be. I honestly can't remember if they did 'Opus Dei' and 'Geburt Einer Nation' but I hope they did cos they are among my favourites. I was disappointed by there being nothing else from NATO and nothing from Jesus Christ Superstar, but with 30 years of material that's bound to happen... also would have liked 'Vier Personnen' and 'Drzava' from Nova Akropola, but what can I do about that.

Right, it was very good indeed. Had I missed this I would have regretted for the rest of my long life. I would happily have watched the show again immediately afterwards, repeatedly for the next seven years. My only regret is not following them to London for the Tate Modern turbine hall show on Saturday. Laibach vor allem. Laibach predvsem. Ich liebe Laibach. Ljubim Laibach. Etcetera, etc, &c

Click HERE for the best of Laibach's amazing music videos

Click HERE for video of the very concert I'm raving about

Das beste von Laibach

Live video of Laibach, Manchester

Thanks to YouTube user polewka123 who shot this footage, with surprisingly good sound quality, seemingly from exactly where I was standing (I can see my head!) //// Amazingly good footage of a wunderbar show:

572: Brain slugs and sippy cups

Sometimes there is a piece missing from my brain; a feeling, a thought, an ability to move. It might last a day or two and then it seems to come back from where ever it has been. The same place the odd socks go to before they get to rejoin their lost partner, or meet a new one, back in the sock drawer. I don't know where that is. If I did I would have many more socks than I have; more than I need. More than I could ever eat. Or wear, in a single lifetime. Maybe a hat fashioned from tin foil, perhaps with a cosy lining of cling film, will keep everything in and/or out. In place/space. I'm not deranging, just re-exploring the way thoughts translate into written words. I barely wrote a thousand words in the last week and feel like Hannibal has sautéd away with capers and lemon, mmm, lobotomised.

I want to describe the way in which I have subjects I wish to blog about (such as the artist Liz West, the Laibach concert, the arrest I saw part of outside the petrol station 'round the corner), but how I just can't string together the required thoughts in order to build a short narrative. All I keep getting is awful cliched metaphor about not being able to grasp hold of threads; little metaphorical threads of something. I just can't grasp those threads. Syphillis? Book worm? Brain slugs? Let's all go to the Brain Slug Planet! Then after every couple of sentences written, I stop, stare at the screen, glaze over, wonder where I am, snap out of it, forget what I have just written, remember I have forgotten what I have just written, go back and read again what I have just written, glaze over a bit more, repeat the forgetting/remembering/re-readin cylce. Then and only then am I able to eek out a couple more sentences. Like these ones.

Then what happened? Well then I just kept on writing more of whatever it is that I am about to write: This Liebfraumilch is like juice. When I was little it was a joke product, like Lada and Skoda were. I can't remember if it was a Lada or a Skoda that my granddad used to drive. Probably a Skoda, but it may have been the other one; the Lada one; I just don't remember. I remember being unnecessarily embarrased to be in it. I was a little weiner. I also used to get embarrassed going into Oxfam in case one of the little prats at school saw me and called me a scratter. I feel sorry for my kids, what with all the scratting for second-hand books they will be caught doing. My kids are scratters. They will drink Liebfraumilch. And Blue Nun. In Tommy Tippy sippy cups.

571: What a way to wallow

After seeing Laibach in Manchester last Thursday (thoughts on that experience to follow shortly) the excitement of experimental music has hit me physically and emotionally, whereas previously the appeal was mainly intellectual in the beard-stroking sense. For those unfamiliar Laibach are a Slovenian military/industrial band/collective who have been knocking around for thirty years, using facist/pseudo-facist imagery to pervert and corrupt covers of Western pop songs. I first heard them in 1996 when the song 'Message from the Black Star' from the album Jesus Christ Superstar was included on a free CD included with Metal Hammer magazine. It was probably the oddest thing on a CD full of poppy crap (Feeder, was it? I can't remember). Soon I had various albums on CD, tape, and vinyl. And we all lived happily ever after.

Now, deep abandonded in the desert of despair, and the drudge of bass/snare simultaneous slo-mo thuds, howlin' wailin' wall of noise and blowin' harps with bad seeds and freundschaft mit Deutsch und Amerikanische. The noise of music, mainly 1980's, often with hints of Germany, From Her to Eternity and other distortions and screams. Ahh, the fun of Throbbing Gristle; the fun of pulling teeth and hitting hammers off fingertips. Cut, by Sylvia Plath, she wrote, 'What a thrill – My thumb instead of an onion. The top quite gone, except for a sort of hinge, of skin. A flap like a hat. Dead white. Then that red plush [...] How you jump – Trepanned veteran, dirty girl. Thumb stump'. What fun.

A video on Twitter of a vomiting metal singer adds to the unpleasentness and Einstürzende Neubauten makes a mess of this room's air molecules. I had them all perfectly lined up. It took me weeks with a pair of tweezers and an electron microscope, but now they are all a-jumble again, and I mus' begin ag'in. The words come so hard, a struggle, a bubble that wont burst, the blood blister on my palm caused yesterday at work when two solid wooden shelves clapped together suddenly, pulling my skin tween their nipping grip. A bite of board that stung and was gone. Almost a week with no words, and now a bloody force that's as hard to read as it is to plop out. Only the leftover liebfraumilch and orange-centred chocolate truffles provide any respite. What a way to wallow.

570: Misdirection then more nonsense

Eeee by gum. It's Saturday. Lots of blog catch-up to do. Spent the morning tidying the flat and the afternoon wandering around Manchester with my dad. Got him measured for his suit cos, you know, I'm getting married soon, I am. Speaking of getting married, it's my fiancee's hen-do tonight. My mum and sister will be stopping in the flat with me tonight so currently I'm home alone, blogging, having a cheeky wee beer or two, and waiting for the female fam' to roll up on my doorstep drunk off two glasses of wine. The real reason I'm writing this fairly pointless diary entry, of interest to literally no-one, is that I've not blogged since Monday, I'm distracted by Britain's Got Talent (and what of it!?), I'm stalling for time and just wasting everyone's time.

If anyone's is still reading, which I hope they aren't, I've just noticed on the Traffic Source section of my blog's stats, that the blog has had five hits for the search term 'how to collect human semen'. Now, I'm no expert (except maybe with regard to my own, but I have no letters after my name to prove my credentials) but I would have thought it a fairly simple, self-explanatory process. Unless of course the collector is attempting to amass the definitive collection; maybe, for instance, a sample from every single man in Cornwall whose name begins with J. Then I would understand the need for a bit of guidance.

Perhaps an issue of larger importance is how the deary-me has 'how to collect human semen' being directing people to this blog? There must be some reason; something I've said, presumably, but at this point I can't remember everything I've written about here. On the second page (of about 7,000,000) on doing a google search for 'how to collect human semen' is a link to an article about Incubi at the 'Miskatonic University College of the Magic Arts'. Which is weird because Miskatonic University doesn't exist. It's a fictional university created by author H.P. Lovecraft who I have blogged about repeatedly. Is this somehow the tenuous link that has brought the semen-seekers here? It must be, because the only mention of semen in this blog (before this admittedly semen-heavy... or -stained), is in a nonsensical free-association inspired by Captain Beefheart's Trout Mask Replica here.

You know, so, erm. That's told you. Now if I hit 'publish' I'll be forever condemning myself to waves of semen-searchers, misdirected to this pointless post about nothing. Dear god. Sometimes I wonder why I write this shit.

569: Two Picture Books

Oxfam book shops are great, even those in decline like the one in Lancaster is. And from Lancaster, over Easter weekend I picked up these two little pieces of chintzy, glittery, bejewelled gold. Unbelievably shitty and confused metaphor aside, what I should have simply said is 'I bought two nice books, and here they are':

Struwwelpeter

or

PRETTY STORIES AND FUNNY PICTURES

By Dr. Heinrich Hoffmann

An edition from 1996, but looking older, this bizarre children's book was originally published in German in 1845. It was written by a doctor who was concerned that all the kids books available were a bit two shit for his precious three-year old so, what with being a doctor and having so much free time on his hands, he wrote and illustrated his own kids book. It is a sort-of pisstake of cautionary tales, morals and fables, and includes such classic stories as the one about the hare who nicks a hunters specs and boomstick, the little thumbsucker who gets his thumbs snipped off with a massive pair of scissors, and the creepy Shock-headed Peter of the book's title. There is also the obligatory racist story about a "woolly-headed black-a-moor" being teased by three little twats called Edward, William, and Arthur. A gigantic wizard-looking chap decides to punish the three tiny knob-heads by dipping them in a massive inkpot. ...yeah? ...?

BIBLE ROAD

SIGNS OF FAITH IN THE

AMERICAN LANDSCAPE

PHOTOGRAPHS BY SAM FENTRESS

Photographs spelling out quite plainly the nuttiness of religious America. Up and down the endless highways, blacktops and desert-tracks are scattered signs reading:

Repent! Confess your sins. God will abundantly pardon. Read 1 Jon 1:9

Justice of the peace Jesus | Righteous Judge Jesus

don't let phony Christians KEEP YOU FROM JESUS CHRIST matt. 7:15-29

CHRIST SEEN ALIVE! Over 500 reports by Eyewitnesses

SOLD OUT FOR CHRIST MINISTRY † BLOOD COVERED (JESUS)

GI E SAT N A INCH & HE'LL B E THE RULER

LA GLORIE DE LA FEMME HAIR STYLIST "JESUS IS LORD"

God forgive me. I have sined. Give me he BLOOD of JESUS. Iamsorry. Please send, the HOLY ghost. Amen

Dios -Es- Amor

REPENT JESUS IS COMING IMMEDIATELY!

YAHWEH ELOHIM

God plus one is always a majority.

My copy also has the added bonus of a handwritten dedication "To Roger & Sue, with thanks for a terrific architecture party! July 2009". For me this raises some questions. What on earth is an architecture party, and could it possibly be as dull as it sounds? What happened between Roger & Sue and the person who gave the gift of this book, which meant that after only a couple of years this book ended up in the charity shop? God knows.

568: Thoughts on Modern Medicine (part 2)

Read part one here, do it, do it now, do not hesitate (unless you've already read it)

Picking up where I left off last October with my piece of puffery, promoting the talents of Tactical Thinking's meisterboys Modern Medicine: It's that Tech-Hop, came to make you break a sweat. And since then the secret seven-track CD I'm storing and sitting on remains unreleased. And sent to me by Bobby Esmond in secret single-time digital download is Modern Medicine's naughty little head-knocking rework of Blur's Girls & Boys. I'm lead to understand that the various incarnations of Modern Medicine, Tactical Thinking and Surreal Knowledge have been sitting on and incubating this hard-boiled beat'n'egg for some time. It's eventual fate will probably be a free promotional download or an exclusive YouTube promo-vid. Apparently.

Let me say, it's about time some more of this new fangled Modern Medicine was made public. Once Phase III trials are completed. As it is I'm shouting about something that might as well not exist; how do you know I'm not making this all up? Let's test the theory: one or more of the following four facts about Modern Medicine are true, and all you have to do is guess which is which and what is what: a) Modern Medicine are not as hip as they look, b) Modern Medicine are banana farmers from Bangkok, c) Modern Medicine spend almost all of their income on manicures, or d) Modern Medicine are a fictional construct born in the brain of a bored baboon in Baltimore zoo. Or..... e) All of the above. Take your pick. But choose wisely, for while the true answer will bring you life, a false answer will take it from you.

A tour is underfoot and under way - away and afoot - and over the past weekend Modern Medicine did (by their own modest accounts) blow all kinds of ceilings; what with all the roof raising and hand waving. There is video evidence because, as we all know, no testimony is sufficient to establish roof raising, unless the testimony be of such a kind, that its falsehood would be more roof raising, than the fact, which it endeavours to establish. True story:

LAST CHANCE: Read part one here

567: Two

Two great opinion pieces in the Guardian/Observer Comment is Free today. Extremely well written and focusing on very important subjects:

So what did the troll actually say?

By Victoria Coren

What terrifies me is that people are nodding happily all over the country, pleased to see a clampdown on internet trolling at last, as if the exact content of the tweets doesn't matter. It matters enormously. If we're going to send someone to prison for saying something, we damn well ought to know what it is he said. Anyone who's pleased to see a person jailed for a piece of writing, without bothering to seek out the precise words that were deemed illegal, should be ashamed of themselves.

It was quite wrong for the media to report the story without those details. They could use asterisks, bleeps and disclaimers, of course. But it's inappropriate and dangerous for a free press in a free country to inform us that someone has been imprisoned for the words he used, without quoting them. What kind of democracy is this, if we don't demand to know what those words were?

Once we had anarchy in the UK. Now all we have is monarchy in the UK.

By Julie Burchill

Characters such as Vivienne Westwood take a break from designing boxes for £90 Fortnum and Mason Easter eggs to drool over this profoundly mediocre family with the same brainless fervour with which they once espoused anarchy. And every time I witness such self-abasement, it makes me feel once more that patriotism and monarchism are actually the opposite of each other – or at best a duplicitous marriage of convenience, such as the one the heir apparent inflicted on his innocent first wife, rather than the love match they pertain to be. Monarchists frequently declare that without the royal family, Britain would be "nothing". What a woeful lack of love for one's country such statements express.

Being a monarchist, and fawning over those "above" you, you must naturally despise those "below" or on the same socioeconomic level as yourself, because that is how hierarchy worship works. It's also about despising yourself, for how could anyone with any self-respect look up to someone who holds their position purely by an accident of birth? Being a monarchist – saying that one small group is born more worthy of respect than another – is just as warped and strange as being a racist.

If I were to have quoted all the good bits I would have just copied the whole articles, and I really ought not to do that. Just read the damn articles and then we can all get on with whatever we were doing before I so rudely interrupted. I've got a chicken to stuff, a face to shave and a bowl of carrots to grate.

566: sausage soup and groovy cosmic

Instead of reading this blog post I have a better idea. Read this recipe for Polish Biała Kiełbasa soup, get the ingredients, make it, eat it, realise it's the middle of the night, got to bed, sleep like a contented fat hog (like you are), fart heartily and repeatedly until a hole is burned through the seat of your pyjamas.

It's a thick white soup made with a base of sausage and onion/garlic stock with sour cream and flour, with great mouthfuls of potato, hard-boiled egg and white Polish sausage. Before Thursday I'd never heard of it but a friend at work mentioned it and its traditional position as an Easter Sunday breakfast, and I knew right then it sounded like the kind of thing I wanted spooning into my face. Not being one for tradition-for-tradition's sake, I made it today and ate some with my dad. We loved it. Don't know how well it reheats (what with all the cream and fat in it) but there is plenty left for breakfast. No priests were about to bless the ingredients.

Barely relevant aside: according to my dad Hare Krishnas had (or have?) that little ponytail so they can be lifted into heaven, as though it is a kind of groovy cosmic space handle. I asked if my toes were hairy so I can be dragged down into hell by them. Maybe that's where I'll be going for eating food made from unblessed ingredients, and for flippantly stealing from other cultures based solely on how delicious they are.

Tomorrow we get to give our niece her Święconka basket. It's an Easter basket. I've never had one myself, but seems like fun. If the weather holds out there'll be an egg hunt at the allotment, hop this way >>> etc.

Anyway...

Dobranoc.

565: Fin. ?

That's it: a tipping point, a high water mark, an event horizon. It's happened. I have officially covered every single subject on Earth. Not just Earth, but everywhere else too. Everything from toast to Nixon, barnacles to hot water bottles, ocelots to Reeboks, tree bark to housework, baseball to bacteria, all of recorded history to Brazilian futebol, Finnish television to South coast seaside resorts.

They are all there in this blog that has gone from the B in the Bang, to the restaurant at the end of the universe, and back again. Might as well pack up the internet, save it, print it, box it up and tie a ribbon round it. Stick it on the shelf and forget about it. It's finished. So from here on in this blog will be dedicated solely to showing repeats (reruns) of previous posts. And Hitler documentaries, Friends episodes, and "entertainment" "news". I've consulted the oracle and can tell you nothing else happens. Even Coronation Street has reached its denouement. Can't go on forever.

Some things will go on for as close to forever as is realistically possible. I'll breathe forever as long as I live, but I won't live forever, unless my thoughts can be stored in the central computer's memory banks. Then in ten thousand years I'll be brought back, if realistically possible. Earth will be here forever, until the sun consumes it or a stray bit of gravity boots it into oblivion. The universe will be here forever, until it crushes itself to a heat death, or spreads out and disperses into infinite cold. And this blog will go on forever until it kills me or I kill it. Or broadband becomes forgotten, like the ability to make fire from stones and moss.

Until tomorrow. Don't let the sleeping dogs lie. Let the bedbugs bite. Read your books and change your locks. Bring your potted plants in for the night; free them from the falling frost. Be-still your fans and dowse your embers. Strain your veg and mash your spuds. Calm your raging rash and tame your temper. Stop the clocks, cut off the telephone. Fluff your pillow, find your page, and do it all again tomoz

564: Huh? The who what now?

The internet makes no sense whatsoever. Somehow the top site referring to this blog today, behind Googles dot-com and dot-co-dot-uk, is one pointless little hate-spout called Americans Who Hate Obama dot-com. Presumably these are the sort of deluded self-hating confused bigots who would have been forming Christians Who Hate Christ sects in Judea circa 25AD. I have no evidence for that, but whatever. It's the sort of website that contains such self-defeating gems of babble as:

We urge you to make your voice heard now, so that generations from today will not look back and say, like they now say for Hitler's regime;- Where was all the good Germans? Where are all the Good Americans?

Er, yeah? I just can't help looking at Obama and being reminded of Hitler. It's like whenever I see Postman Pat I'm reminded of Genghis Kahn. Whenever I see Dr Sam Beckett I'm reminded of Dame Edna Everage. Whenever I see Chandler Bing I'm reminded of Harold Shipman. Humphrey Bogart reminds me of a mutant turtle called Donatello, teen-aged and skilled in the art of ninjitsu. Richard Feynmann reminds me of General Zod and, conversely, King Zog reminds me of Nina Ricci.

This is because I have a chemical imbalance in my brain stemming from a severe head injury in a previous life. The shockwaves of the incident reverberate through time and I am still bobbing on the eddies generated in past aeons. That bloomin' Hitler, eh. What a twat he was. Such a bastard. Always trying to provide better access to affordable health care, wasn't he. We never did see Hitler's birth certificate did we. We did? Pah, obvious fakery.

I'm babbling badly-written nonsense obviously. But no more so than the extreme Americans who seem stubbornly ignorant to the complete differences between Socialism and National Socialism. The thought path seems to be: Obama wants to help the weakest in society and prevent the strong from unfairly exploiting the weak & society equals Socialism & Socialism equals Fascism. As if all of a sudden the strong need protecting from the weak. We demand our freedom to oppress. Blah blah blah.

This post was going to be about how boring, middle of the road, emotionally flat, and samey all those dreary songs by Adele are. It still is about that, but it's also about a pile of other crap too. Or something, or nothing. I think I might have drifted off halfway through. Bedtime, fo' real. Stop writing and go to sleep.

563: Hold the front page

Things happen. Stuff. There's a world that we live in, this one here (do you see it?), and there are things happening all over it all of the time. Some of them are interesting; in fact, they are probably all interesting if looked at from an original perspective. There are the things that bloggers are supposed to talk about, which is basically anything that trends on twitter. Technically I should have offered my commentary and analysis on the NHS, the budget, #Kony2012, George Galloway and Samantha Brick. Every internet obsessive, aspiring writer, and inane hipster just has to say the same things about the same things. Rehashing the twitter top trends, any old stuff from BoingBoing and retronaut (where the stuff comes from). Cos that's what we do.

But I don't have a thing to say about everything, or anything. I wish I did, but I don't. It's not for want of trying. I used to think it was a positive to pretend to have an opinion on everything. But there's just too many things that I am utterly unqualified to have a valid opinion on. The budget, for example. I just don't get it. I don't get if the economy is fucked up because the people in charge are so shit and corrupt, or if their inherent shittiness and corruption is just being highlighted by a struggling economy they have no real control over. I don't get it.

All I've learnt this week is a lesson from the Samantha Brick thing. (If you don't know what that is read this, then this, then this.) Samantha Brick has taught me that there are occasions when it just may be ill advised to pour out ones every idiotic thought into a blog post (or email to Daily Mail editor). It's also probably a lesson that if the Daily Mail wants to offer you a regular job you just may be a self-satisfied prick of magnificent proportions. So far I haven't heard a peep from the Daily Mail headhunters so I must be ok so far. If they ever do come knocking I'll know I really am the total prick I always feared I might be.

But anyway, when stuff happens in the world, don't come looking to me to tell you about it. I would love to be able to write knowledgeably on current affairs but I don't think I've got it in me. I'm just not clever enough, quick enough, or beautiful enough.

562: 1st thoughts on The City and the Stars

The City and the Stars

Arthur C. Clarke

The City and the Stars. 'Probably his most perfect work' reads the blurb on the front cover, quoting from the Encyclopedia of Science Fiction (whatever that is... I think it might be an encyclopedia of some description). Don't believe everything you see on the cover of a book; don't judge a book by its cover. Once upon a time Arthur C. Clarke was directly responsible for the dark ages of my science fiction fandom, when after reading 2001: A Space Odyssey I was so disappointed I left off s-f for years. It was something about the vast memory banks on the space ship being a really, really big room full of magnetic tape. The lack of creative ambition in that picture utterly sickened me. Sickened me, I tell you.

Sometimes, however, what you read on the cover of a book turns out to be true. Hyperbolic, and subjective, and unverifiable perhaps; but true in all the important ways. It might be his most perfect work, I have no idea, but the point I'm circumventing is that it is brilliant. So far, in my tentative daliances into the world of science fiction literature I have discovered a budding preference for stories set in the far, far, far, far, far, far, far, far, far, far, far, far, far, far, far far,af,ar,far future over those in the near future. Even more so I seem to be enjoying stories about the gradual discovery of the history leading up to the fictional future. Isaac Asimov gives us lots of that in the Foundation series – I particularly enjoy the morsels he gives us about the fall of the Spacer worlds.

Stop the press. Having just mentioned the Spacer worlds thought suddenly strikes me about the eventually discovered state of Solaria, the last of the fifty Spacer worlds to be colonised, and seemingly the first to fall. In Foundation and Earth we discover that in fact it did not fall, was not abandoned, but the Solarians actually retreated underground, cutting themselves off from the rest of humanity. They maintained a small planet-wide population of about 10,000 (give or take a factor of ten, I can't remember), each individual living a solitary life served by an army of robots. They genetically engineered themselves into hermaphrodites who reproduce by cloning, and who manipulate their environment using 'transducer lobes' growing on their necks. Very weird stuff. They survive in their perfect self-imposed isolation for many tens of thousands of years.

There may be many parallels between Asimov's Solarians, and Clarke's Diasparians. The far-future humans living in the Earth city of Diaspar have perfect self-imposed isolation. They live strange endless lives, never really dying or being born; merely living for thousands of years, then disappearing into the great memory banks of the cities all-powerful controlling computer. After tens of thousands of years interval they are recreated as flesh. The city is constantly repopulating itself with different variations of the same individuals. Individuals who cannot and will not leave their city. They are not hermaphrodites, but have no sexual reproduction and no external genitalia. They have no knowledge of the outside world or any desire to contact it.

There are probably lots of comparisons to be drawn and I will no doubt be thinking about Foundation and The City and the Stars for many billions of years. In the meantime I must sleep.

561: Murdering Malvina

There is a current series of adverts, I think ostensibly for O2, which rather than urging me to buy mobile phones fills me with the rich and true desire to penetrate the glass of my television screen with the corner of the coffee table. To start biting chunks off my own body, flicking and flinging them at the offensive flickering window into the world of corporate-cocksuckery. When something of real non-monetary value, a cherished song for example, is perverted into the charge of selling shit to impressionable idiots, it can really hurt (as Stewart Lee expresses so well in If You Prefer a Milder Comedian... - his former favourite song Galway Girl by Steve Earle butchered in the name of pear cider).

I've loved the song since childhood (admittedly with a pretty long hiatus between the ages of seven to twenty seven, at a guess), and blogged about it way back (150). It's Little Boxes, the satirical non-conformist 1962 folk song by Malvina Reynolds, and it's one of those perfect little works of art that should make advertising executives and marketing slugs tremble, avert their eyes and close their ears. Its sheer honesty, sincerity, passion, power and beauty should melt them like the Wicked Witch of the West doused in water, oh what a world, what a world. All responsible for the bastardisation of this song deserve their place in a hell especially constructed with them in mind; their very own realised room 101.

When did it become ok for artists to do adverts? In the 1980's when I spent my formative years no serious artist worthy of the name would have done adverts; adverts were for the corporate cocksuckers. In the 1990's it started slipping, just ask Bill Hicks. He knows:

By the way, if anyone here is in marketing or advertising...kill yourself. Thank you. Just planting seeds, planting seeds is all I'm doing. No joke here, really. Seriously, kill yourself, you have no rationalisation for what you do, you are Satan's little helpers. Kill yourself, kill yourself, kill yourself now. Now, back to the show. Seriously, I know the marketing people: 'There's gonna be a joke comin' up.' There's no fuckin' joke. Suck a tail pipe, hang yourself...borrow a pistol from an NRA buddy, do something...rid the world of your evil fuckin' presence.

If you can ignore the dated pop culture references:

. . . "We're rock stars who do Pepsi Cola commercials!" Luckily Satan's dick has many heads, so all these little demon piglets can nuzzle up and suckle all at once. Here comes a fella named Vanilla Ice. Here comes MC Hammer. Here's Madonna with two heads. Suckin' Satan's pecker. Suck it! It's only you're dignity. Suck it! It's only your dignity! Suck it! . . . I am available for children's parties, by the way.

Now the demon seed of O2 and Satan is a disgusting twee reduction of Little Boxes to a hipster-bait jingle for a fucking telephone. I refuse to post the advert on this blog but it's out there; instead I'll post the original so you can bask in its quiet, gentle ferocity. And I'm off to patent my design for a new type of television remote control. It has a giant mute button that you wear on your forehead, and every time that accursed O2 advert comes on you can silence it by headbutting the nearest wall or pet.