580: Random Topic Generator

Here is a random subject generator; a tool for bloggers utterly devoid of inspiration and internal thought process. It's been almost twenty four hours since the last time I was called upon to write words, on a piece of non-existent paper, and during that time I've slept, been to work, spoken to various people about various things, shopped for spectacle frames, eaten Greek lamb and lentils in Manchester Arndale Market food court, ridden the tram, had a nap, watched a pretty good music video that features a friend's severed head mounted on a wall, made and eaten a delicious shepherds' pie, and here we all are. Also during that time my friend and godson have come to stay with us from Tanzania.

Despite all this activity I am reduced to clawing helplessly at the dregs of the random subject generator. How random it is, I do not know, since I have only seen, so far, the first subject it has generated. It is possible, and indeed likely, that it only actually has five subjects which it serves up cyclically in order to every helplessly empty-minded sucker who sucks. And here I am, helpless, empty-headed, and sucking, and the subject served to me is The autonomy of nude art. What this piece of code doesn't know is that I have already done my blog about nude art, here: My "Private" Library. What it also doesn't know is that I finished my art degree about seven years ago, and thus have no interest nor reason in unpicking the meaning behind pretentious phrases like The autonomy of nude art. There's just no need. No need at all.

Your favourite novels; Simple origami; Religions – ranked by age; A word that means something to you; Where to rent good snowboards; Chocolate, good or bad for you?; Nutrition for young kids; Your worst enemy; Your favourite dinosaur; The birth of Jazz; George Washington in the Revolutionary War; Cities to visit; DNA notations; A movie poster that has affected you; Music and mathematics; How to cut your spending. Those are the topics. There may be others but we haven't got all day. I can't tackle all of those so I'm just going to throw darts at the screen and wherever they stick, that subject, by dint of blind chance, becomes worthy of a sentence or two.

DNA Notations:

CTACGATCGATCGTACTGATCGTAGCTAGCTAGTCGATCGATCGTAGTCGATGCTACGTAGCTAATGACGATGCTATGCATAGTCGTACGTACGTGTGTGTTTAATTATATCGATCGATCGATCGATGCGCGCTACGTACGATCGATGCTAGCTAGCTAGCTAGCTGATCGATCGTAGTCGATCGTATATGCGGTCAGCGATGTATCGGGCGCGGGGGGCGCGAGATAGTATGCATGTAGCTTAGGAC

Cities to visit:

All of them, from Aalborg to Żywiec.

Where to rent good snowboards:
I don't know. Halfords, or somewhere.

A word that means something to you:
Word.

How to cut your spending:
Stop saying, "oh my god, I need those shoes, I don't know when I will wear them, but they are just so cute. Should I get them? I'm getting them."

Well, that went well.  More of the same tomorrow?

563: Hold the front page

Things happen. Stuff. There's a world that we live in, this one here (do you see it?), and there are things happening all over it all of the time. Some of them are interesting; in fact, they are probably all interesting if looked at from an original perspective. There are the things that bloggers are supposed to talk about, which is basically anything that trends on twitter. Technically I should have offered my commentary and analysis on the NHS, the budget, #Kony2012, George Galloway and Samantha Brick. Every internet obsessive, aspiring writer, and inane hipster just has to say the same things about the same things. Rehashing the twitter top trends, any old stuff from BoingBoing and retronaut (where the stuff comes from). Cos that's what we do.

But I don't have a thing to say about everything, or anything. I wish I did, but I don't. It's not for want of trying. I used to think it was a positive to pretend to have an opinion on everything. But there's just too many things that I am utterly unqualified to have a valid opinion on. The budget, for example. I just don't get it. I don't get if the economy is fucked up because the people in charge are so shit and corrupt, or if their inherent shittiness and corruption is just being highlighted by a struggling economy they have no real control over. I don't get it.

All I've learnt this week is a lesson from the Samantha Brick thing. (If you don't know what that is read this, then this, then this.) Samantha Brick has taught me that there are occasions when it just may be ill advised to pour out ones every idiotic thought into a blog post (or email to Daily Mail editor). It's also probably a lesson that if the Daily Mail wants to offer you a regular job you just may be a self-satisfied prick of magnificent proportions. So far I haven't heard a peep from the Daily Mail headhunters so I must be ok so far. If they ever do come knocking I'll know I really am the total prick I always feared I might be.

But anyway, when stuff happens in the world, don't come looking to me to tell you about it. I would love to be able to write knowledgeably on current affairs but I don't think I've got it in me. I'm just not clever enough, quick enough, or beautiful enough.

528: Anatomy of a Blog Post

Sometimes it's hard to start writing a blog post. Things I can see: a This is Spinal Tap DVD, an empty toilet roll tube, a Jew's harp (or Jaw harp if you prefer), 30^th birthday cards all pushed together and standing atop the FreeSat box, a small red plastic chair for a child, How Not To Grow Up by Richard Herring, a pocket hardback about Hokusai with The Great Wave compulsorily on the cover, a glass of delicious Kraken black spiced rum, an empty and a half full bottle of nail polish remover, a child's toy accordion still in the colourful cardboard box, a Peppa Pig height chart. That is everything of importance. Everything else in the room fits under the umbrella term "miscellanea and trivia".

Sometimes it's hard to continue a blog post smoothly into the second paragraph. Either one communicates too much in the first paragraph leaving little else to be said, or one communicates too little in the first paragraph meaning the second has little to go on. So now is as good a time as any to admit I have become addicted to Failbook ("Social Media from Facepalms to High-Fives"). Conservative estimates judge the time I spend flicking through Failbook, further and further back in time, to be too much. They also judge it to be puerile and time wasting, but then again those conservatives are so judgemental. I assume.

By the third paragraph I often find myself checking the word count (245) to see how close I have come to an acceptable minimum length. The usual result is to discover that there is not nearly enough words being counted by word count, and I'll have to work a bit harder, push a little further, in order to give word count more words to count. Word? (299) (300) By this point I'm usually approaching the end of paragraph three and just beyond paragraph four I can see the tedious conclusion looming.

Paragraph four's role is usually that of a summation or conclusion. Or, if you prefer, a denouement. So at around this point I am writing more words to extend the word count, doing a call back or two to an earlier allusion (or two), and hoping, if at all possible, to end on a joke. I like jokes; they are funny. Sometimes it just seems more appropriate to just cut to the chase, cut my losses, give up the ghost, stop. Just skip to the end, i.e. the bit that says The End, or if you prefer, Fin. At this point I've not worked out which of the two options to take. (436)

465: November nearly over

Every time I hear this song by Katy Perry it makes me think of this song by G.G. Allin. Perhaps we should introduce Katy and GG so they can satisfy their disgusting fantasies together. Perhaps if GG wasn't dead... and a filthy excuse for a human being... Anyway, forget I mentioned it; it was just a reoccurring thought I needed to get out of my system.

We are nearing the end of the month, and that means the end of National Novel Writing Month. I am ashamed to say I have failed abysmally. In the first week I got a huge amount done – leaps forward in terms of word count and general development of plot and character. The second week I was exhausted and feeling burned out – not only did I stop working on the novel, I also neglected the blog. The third and fourth weeks I have become excited about writing again, but have been concentrating on research and note taking, with a bit of time spent on actual writing. I have also tried to catch up with blogging again but am still limping a little behind.

These last couple of days I have been obsessed with following and taking a small part in this Burzynski cancer quack blog war. It's very exciting to see how quickly it has snowballed, and people whom I have great respect for have taken up the cause on twitter: Stephen Fry (@), PZ Myers (@), Simon Singh (@), Dara O Briain (@), and Ben Goldacre (@). I think it very important to stand up in support of a cause like this and, to use the cliche, say 'I'm Spartacus' even if I'm not really. Very excited to see how this develops. And amused by the random string of coincidences that drew this burgeoning mini-revolution to my attention.

Lately the dry and dusty conditions of my day job have lead to really badly cracked skin on my hands, and as a result I enjoyed an exfoliating and moisturising hand massage, using hemp hand cream, and gifted to me by my wonderful fiancee. Tomorrow we will go to the cinema and perhaps Yo! Sushi. Stike that: definitely go to Yo! Sushi. Yo God, I love Yo! Sushi. So instead of churning out the seven blog posts that'll put that important "(30)" beside the month of November in my Blog Archive, I'll be out enjoying myself. Sometimes when I'm writing I forget about life. Unless I'm actually writing about my life, which I find embarrassing and try not to do. Plus it's boring. If I was an explorer of the ruined Antarctic city of the Elder Ones, or the latest drummer in Judas Priest, I might write about my comings, goings, and doings a little more often.

Had a really good idea for a novel, or long short-story, today. It's safely recorded in my notebook; I'm glad I started taking that to work with me. Don't worry, I'll finish the first novel before I start on the third.

Night.