590: Two Pictures

A mouse autopsy, yesterday.

This picture of an eukaryotic cell is a mouse. It isn't a mouse, but it looks just like one pinned to the autopsy bench with its viscera splayed open for all to see. Eukaryotes are multi-celled life forms including plants, fungi and animals, and some single celled things from other lesser known kingdoms. Fascinating, no doubt, but beyond my current ken, and momentarily I'm more interested in this particular one looking like a mouse. Ooh, isn't it cute, yes it is.

This picture of a guinea pig is someone's dinner. It isn't a pet; it is an animal domesticated and farmed to feed hungry humans, especially those living in or visiting Peru. Sipping hot cocaine tea and tucking into a crispy roast rodent before tottering off to Machu Picchu to admire the stonework. Looks delicious. I'm off to bed to dream of eating furry little squeakers.  Ooh, isn't it cute, yes it is.

A guinea pig delicacy, yesterday.

580: Random Topic Generator

Here is a random subject generator; a tool for bloggers utterly devoid of inspiration and internal thought process. It's been almost twenty four hours since the last time I was called upon to write words, on a piece of non-existent paper, and during that time I've slept, been to work, spoken to various people about various things, shopped for spectacle frames, eaten Greek lamb and lentils in Manchester Arndale Market food court, ridden the tram, had a nap, watched a pretty good music video that features a friend's severed head mounted on a wall, made and eaten a delicious shepherds' pie, and here we all are. Also during that time my friend and godson have come to stay with us from Tanzania.

Despite all this activity I am reduced to clawing helplessly at the dregs of the random subject generator. How random it is, I do not know, since I have only seen, so far, the first subject it has generated. It is possible, and indeed likely, that it only actually has five subjects which it serves up cyclically in order to every helplessly empty-minded sucker who sucks. And here I am, helpless, empty-headed, and sucking, and the subject served to me is The autonomy of nude art. What this piece of code doesn't know is that I have already done my blog about nude art, here: My "Private" Library. What it also doesn't know is that I finished my art degree about seven years ago, and thus have no interest nor reason in unpicking the meaning behind pretentious phrases like The autonomy of nude art. There's just no need. No need at all.

Your favourite novels; Simple origami; Religions – ranked by age; A word that means something to you; Where to rent good snowboards; Chocolate, good or bad for you?; Nutrition for young kids; Your worst enemy; Your favourite dinosaur; The birth of Jazz; George Washington in the Revolutionary War; Cities to visit; DNA notations; A movie poster that has affected you; Music and mathematics; How to cut your spending. Those are the topics. There may be others but we haven't got all day. I can't tackle all of those so I'm just going to throw darts at the screen and wherever they stick, that subject, by dint of blind chance, becomes worthy of a sentence or two.

DNA Notations:

CTACGATCGATCGTACTGATCGTAGCTAGCTAGTCGATCGATCGTAGTCGATGCTACGTAGCTAATGACGATGCTATGCATAGTCGTACGTACGTGTGTGTTTAATTATATCGATCGATCGATCGATGCGCGCTACGTACGATCGATGCTAGCTAGCTAGCTAGCTGATCGATCGTAGTCGATCGTATATGCGGTCAGCGATGTATCGGGCGCGGGGGGCGCGAGATAGTATGCATGTAGCTTAGGAC

Cities to visit:

All of them, from Aalborg to Żywiec.

Where to rent good snowboards:
I don't know. Halfords, or somewhere.

A word that means something to you:
Word.

How to cut your spending:
Stop saying, "oh my god, I need those shoes, I don't know when I will wear them, but they are just so cute. Should I get them? I'm getting them."

Well, that went well.  More of the same tomorrow?

410: A Thumb

I have an excuse as to why the blog has not been updated for a couple of days; it's quite a relief to have a genuine reason (however convenient) other than just plain laziness. I've had an achy thumb. The ball of my thumb (the mount of Venus it's called, as I learned from reading Dr. No) has been killing me for a couple of days now: repetitive strain from my job, which involves a lot of thumb action, as does typing. On top of that I've recently got the Mega Drive emulator, Fusion, and been playing Toejam & Earl, Streets of Rage 2 and Road Rash 2. And Angry Birds on Google Chrome. I just closed my eyes and rubbed them, and could see a catapulted round bird bouncing off a tottering tower of wood and stone blocks. This might be a more accurate and honest account of why I've stumbled updating the blog. More for the catch-up bank.

It's now the first of October (are you listening, future generations?) and I am absolutely sweating my skin off – my entire epidermis is (not-)literally slipping off my sweaty skeletal system and pooling on the bed sheet. This is the beginning of the end of the world. Everything goes topsy-turvy (dogs and cats living together in harmony) Christmas will be in summertime like the Australians have it – then the world just stops. The 2012ers were (are? will be?) right with their fantastical, fatalistic, and flawed interpretation of the Mayan calendar (a subject which I just happen not to be an expert in). You'll see. Just look around and you'll discover that calendar manufacturers (a kabalistic, knowledgeable bunch) have opted out of printing 2012 calendars, and are instead putting all them money into canned food and shotguns.

Soon it'll be us who are endangered and the panda bears, with their weird different panda-thumbs, will be coming down from the trees and manipulating mouses and pushing buttons – converting everything from decimal into base-12 cos of their freaky five fingers and a pseudo-thumb on each hand. They are the Hitchhiker's Guide mice. Don't trust pandas. Or calendar manufacturers. Or Australians. Not for any reason; just as a precautionary measure. Stick to that rule and we may just eek out a subsistence post-2012. Good luck, god speed, live long and prosper.

Streets of Rage 1 is next to unplayable and extremely tedious, whereas Streets of Rage 2 is fantastic: great music, action, characters. Now that's progress. Soon I'll be ready to move on to Streets of Rage 3. Eventually I may move onto 32bit gaming, or whatever futuristic delights and wonders can be found beyond. You know, if there is time before the big heat death the world is free-wheeling into.

409: A Wasp

There is a wasp at the window; what am I going to do?  It's not knocking on the outside, trying to get my attention, desirous to be allowed in.  It Is hiding behind the curtains which I have yet to open, mostly waiting silently, but occasionally generating a buzz with a calm rising inflection.  The sudden heat(wave) has meant that the window must be kept open at night, despite the fact that the Britannia Hotel (Portland Street, Manchester) already has a Christmas tree erected in the lobby.  I know this not because I go to hotels, but because my fiancée went there a couple of days ago for her Zumba workout.  There is something strange in here; something not quite right  Oh, it's the winter festival three months hence, already being celebrated, despite the heat still gripping this small Northern Hemispheric isle.

None of this has occurred to the wasp, I presume to know; it merely struggles to find freedom.  To break away from the endless flat force field keeping it from moving forward.  It is trapped and its few tiny synapses do not contain power or appropriate context necessary to formulate an escape plan, or even comprehend its predicament.  On Sunday I killed a wasp in the Tollgate pub, armed with a beer mat and a pool cue.  Yes, it was armed with a pool cue, and I still bested it in mortal combat.  It was so small and weak it might as well have been an insect.

I am a benevolent ruler, and have decided to grant it freedom.  With Fred Hoyle's The Black Cloud I will bat the stripy interloper out of the open window, and from that point on it is left to its own devices.  Freedom to fall a storey to the gravel below, or take to the skies to find wood pulp or pollen to take home to its brood.  Be gone, buzzy one.

OK, that's strange: I see no sign of it.  I lifted aside the curtains but found no wasp, not walking the windowpane or hiding within the rippling surface of the curtain cloth.  I pushed open the window more to widen the gap, and let the curtains fall back into place.  Another buzz signalled the continued presence of the wasp; or did it signal the freedom which the wasp had taken for itself?  I cannot see it, so until evidence says otherwise I shall assume it has escaped my jurisdiction.

343: Caution: Fod.

In the tunnel wot attaches itself to the side of the plane – the boarding tube – the walkway – the gangplank – I observed a small warning poster which read "Do not leave fod". I thought this an 'ilarious misprint, but reading on, it continued, "Fod should be deposited in the fod bin provided". As if to highlight the intentional use of this unusual word it had a low-resolution colour photograph of a bin with the word fod printed on it. I was hoping I would be able to get some mileage out of this unknown and mysterious, pointlessly cryptic word ; it is on an information sign yet is a word so obscure as to contain no useful information for the casual glancer. However an "I'm feeling lucky" search takes us straight to the wikipedia page: Foreign Object Debris/Damage.

Given that the two other options are the Green Day song, and the Friends of Dorothy, I'd say the foreign object thing is the most likely. Wikipedia helpfully illustrates the danger of foreign objects with this lovely picture of an owl sitting on a wire. Then there is a load of boring old rubbish about planes and such stuff. Some people like that sort of stuff, but I'm not one of them. I only like exciting stuff, like books, cooking and drawing. Not boring stuff like planes. What's so great about them ; all they do is fly through the sky taking us to distant destinations in a matter of hours, that 100 years ago would have taken months and meant almost certain death. Well boring.

What is absolutely and completely – certainly – in no way boring to discuss, is that ubiquitous ever-changing always the same phenomenon: the weather. Let's talk about the weather. I don't know what it's like back home but I'm willing to bet it's occassionally a wee bit sunny, lots of rain, occassional blue sky, lots of cloud and overcast. Here it is baking hot, but page-turningly windy. It's the middle of the night now and the thermometer in the living room registers 30 degrees and I am melting under the weight of my knee-rested laptop. Poor me, poor poor me... pour me another icecold glass of sangria.

Time to get back to meh reading ; got way too many books to get through this week. I'm gonna be all literati an that bye da enda da weak n dat. Gud nite to u, be u amercin or englander, yourapeon ur otha foriner; gud nite to u all. Remember to put sun cream on in the morning and try not to fall asleep in direct sunlight ; some one may write a rude word on your chest or forehead with factor 60 sun cream. Drink plenty of water. That is all.

Hard drive archeology (rescued from forgotten folders with uninformative names)

160: The inevitable conclusion here >

My invisible brain slug has again eaten the juices from the portion of my head usually charged with remembering to write the blog, so I best just wing it and hope I can get to the end on the last dregs of fuel.  Along the route I will leave a trail of mixed metaphors, broken promises, empty McDonald’s boxes and ugly chunky overlong sentences that seem to have completely changed the topic of discussion at some point between the beginning and the end.  Whatever happens, don’t you worry your pretty little head; I’m wearing goggles (for gogging), rubberised booties and a big purple helmet.  I’m fully protected against any danger or accidental indiscretion.

And now we begin a gentle roll over the crest of the hill before gathering speed, hitting bumps, wobbling slightly before losing our balance and disgracefully arse over tit over ankle over elbow, crashing and falling down and down and down.  Eventually we come to a rest, broken battered and bruised, but where we want to be at the bottom of the hill.  We try to stand but the loose wobbly and crunchy sacks that used to be our legs are no longer viable as transport.  All we can do is curl into a ball and hope the breakages heal before infection or starvation claims us for the Grim Reaper.

But on the bright side, it might all turn out jolly.  I or we might finish this blog without tragedy or idiocy or offensive jabbering nonsense, and then we can all just get along with our lives splashing and flapping in a happy stream of peace.  Wouldn’t it be lovely?  Aye, t’would that, t’would that.  You’re not wrong there.

Sometimes exhaustion and that desperate need for sleep cannot be fought any longer.  My shitty fucking day job has one of these employee handbooks full of the tedious and the bleeding obvious.  One of the rules forbids falling asleep at work.  It warrants immediate dismissal.  I’ve never fallen asleep at work before, but I expect it would be a sign of something going wrong in my life, physically or psychologically.  I’m not at work now, and can barely string a thought together.  In fact I can barely lift my head above keyboard-level and my eyelids above pupil-level.

In summation today’s blog started off pretending not to be about being tired, but hiding the fact poorly.  Continued with a oddly depressing little story about falling down a hill and injuring oneself, made even more confusing by the first-person plural pronoun.  Then there was another bit, and then it sort of dragged on until the inevitable conclusion here.